Good News: We bring it, we make it.
![US Flag against blue sky. [Size small, 248 x 248] Tags Good News Gnus](https://images.dailykos.com/images/689612/large/USFlagagainstblueskysmallTagsGoodNewsGnus.jpg?1561513575 "US Flag against blue sky. [Size small, 248 x 248] Tags Good News Gnus")
We are patriots.
The Good Gnus group is a community of readers, writers, activists, supporters, community builders, and patriots. We begin gathering every day at 7 a.m. ET to celebrate national good news. Our most active members are of course a subgroup of members of Daily Kos, whose Front Pages celebrate “News, Community, Action.” However, you don’t have to be a member of Daily Kos to be a Gnusie.
We are realists, not fools, idiots, or ostriches. We know we live in a world where active, nefarious, and evil decision-makers do very bad things and create stress and anxiety in us, our loved ones, our friends, our allies, and our neighbors, and destroy people and systems we hold dear, yet we choose to focus on the good news that people create around the country. Sometimes we ourselves create Good News. Together we are strong and resilient. We return regularly to these pages to revitalize.
Good Gnus: Scientists have deciphered the Coronavirus genome and modeled it!
Be sure to check out the images of all the virus’s proteins in the New York Times article!
OMG, science.
“In January, scientists deciphered the genome of SARS-CoV-2, the virus that causes COVID-19. Researchers are now racing to make sense of this viral recipe, which could inspire drugs, vaccines, and other tools to fight the ongoing pandemic.
“The genome of the new coronavirus is less than 30,000 “letters” long. (The human genome is over 3 billion.) Scientists have identified genes for as many as 29 proteins, which carry out a range of jobs from making copies of the coronavirus to suppressing the body’s immune responses.
“The first sequence of RNA letters reads:
NSP13 - Unwinding RNA - Scientists suspect that NSP13 unwinds intricately twisted RNA so that other proteins can read its sequence and make new copies.
“auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag
“This sequence recruits machinery inside the infected cell to read the RNA letters — a, c, g and u — and translate them into coronavirus proteins.”
See the 3-D images of the proteins in the New York Times article! Dedicated Scientists worked for all of us. Yang Zhang's research group at University of Michigan, my alma mater, created the 29 protein models.
Sometimes I think that people who do not support science should not be able to benefit from science. Sigh.
“Why is modeling the proteins significant?” Question posed and answered by wesmorgan1 in the comments:
I’ve elevated this impressive comment at 9 p.m. ET. What follows is the whole comment (3,000 words):
If you’re wondering why the step from ‘mapping the genome’ to ‘modeling the proteins’ is significant…
...here’s a (greatly simplified) plain English version of how this all plays together:
- The sequence of nucleotides in DNA/RNA dictate the sequence(s) of amino acids used to build a particular protein (‘mapping the genome’ gives us this bit)
- The sequence of amino acids, in turn, dictates the primary structure (think ‘physical shape’) of the protein (this is the ‘modeling the proteins’ part)
- The physical shape of the protein dictates the protein’s function
When you read something like this:
Scientists exploring how coronaviruses like COVID-19 infect human cells have shown that the SARS-CoV-2 spike (S) glycoprotein binds to the cell membrane protein angiotensin-converting enzyme 2 (ACE2) to enter human cells.
COVID-19 has been shown to bind to ACE2 via the S protein on its surface.
they’re basically saying that the shape of the ‘S protein’ on the surface of the COVID-19 virus “fits” a protein (ACE2) on the surface of human cells, much like two jigsaw puzzle pieces — the 2 proteins ‘bind’, and that’s how the virus hooks into the cell to do its dirty work.
So, how does knowing the binding behavior, the proteins involved, and their physical shape help us fight this thing? Well, here’s where all the different approaches/techniques work at different stages:
- Hygeine — handwashing, cleaning with bleach, alcohol-based sanitizers, etc. — works against the physical structure of the virus ‘in the wild’. Soap-and-water dissolves that protective layer of fat, and bleach/alcohol break down those surface proteins...and since a protein’s job is determined by its shape, even a partial breakdown of a protein’s structure renders it incapable of ‘doing its job’.
- Antiviral drugs work by preventing virus replication — usually by interfering with one step in the replication process — but don’t kill/eliminate the virus itself. For instance, Tamiflu works by blocking a particular enzyme that the virus uses to get from one cell to another. (NOTE: Some antivirals have side effects affecting healthy cells.) Knowing how/where a virus binds to a cell can help narrow down the search for effective antiviral drugs; they can figure out the best way(s) to limit virus replication without unnecessary damage to healthy cells.
- Antibodies are produced by the body to match particular infectious agents. They’re proteins, too, made to “fit” a particular invader (called an ‘antigen’). Basically, an antibody ‘binds’ with its counterpart antigen before the antigen can bind with a healthy cell. This bound pair (called an ‘immune complex’ or ‘antibody-antigen complex’) is effectively inert and can, in most cases, be eliminated quickly by the body. This is why plasma transfusions from those known to have recovered from infection can help critical cases; it’s basically a short-term dose of antibodies, which buys time for the recipient’s body to produce more antibodies of its own.
- Vaccines work by ‘training’ the body to produce antibodies for a specific antigen (e.g. smallpox, influenza, et al.), so that the body knows how to make the antibodies if/when a “for real” infection comes along.
Democratic senator Elizabeth Warren may have ended her 2020 presidential run, but the tech used to drive her campaign will live on. Members of her staff announced they would make public the top apps and digital tools developed in Warren's bid to become the Democratic nominee for president. "In our work, we leaned heavily on open source technology — and want to contribute back to that community … [by] open-sourcing some of the most important projects of the Elizabeth Warren campaign for anyone to use," the Warren for President Tech Team said.
Many of us are using hydrogen peroxide to kill certain viruses. It should of course be kept in the dark. Apparently, once opened, hydrogen peroxide lasts 30 to 45 days. You can smell vinegar and alcohol, but you can't smell hydrogen peroxide, so how can you determine if it’s still active and effective? Here’s my solution:
I had an old bottle of hydrogen peroxide, and I wanted to check its efficacy. Here’s a test to check the efficacy of your hydrogen peroxide:
Pour about a tablespoon of hydrogen peroxide over a slice of raw potato. An enzyme (catalase) in potatoes splits the hydrogen peroxide into water and oxygen. Therefore, if you see a lot of bubbles, your peroxide is fresh enough to use. The bubbles last a long time, probably due to the starch in the potatoes.
When I worked in the operating room, staff sprayed the horizontal surfaces of all tables with a disinfecting solution after a patient had left the room, and we were supposed to let that sprayed-on solution air dry.
My goal in bringing groceries into my house is to cover the surfaces I need to clean with hydrogen peroxide and let it air dry, to allow time for the peroxide to work. I use a spray bottle set to create a fine mist. The Safe Grocery Shopping video of the Grand Rapids doctor that I mentioned last week now has 24 million views. One of my objections to that video is that Dr. Vanwingen wipes the surfaces of his groceries with a cloth that does not seem to be moist enough, and then he does not wait for the cleaning solution to evaporate.
![Black words "Celebrate! Religious Freedom Day" superimposed over a circle of free-form, dynamic, rainbow-colored dancing or flying figure-pairs on a white background. The color of each half pair is slightly different from the color of the other half. [Religious Freedom Day]](https://dk-uploads-prod.s3.amazonaws.com/images_placeholders/deleted_large.png?1568544392)
